ResearchHHV-6 Testing HHV-6 Probes for FISH

HHV-6 Probes for FISH

  1. The most commonly used probe is plasmid ZVH14, which has a 8.7 Kb Hind III digested fragment of HHV-6 GS strain. References: Salahuddin 1986, Biberfeld 1988, Levine 1992, Saito 1995, Valente 1996, Wagner 1997, Clark 2006, Nacheva 2008, De Pagter 2010, Strenger 2011
  2. Another is plasmid ZVB70. It contains a 21.4 kb BamHI fragment of the HHV-6 strain GS subcloned into the plasmid vector Bluescript. References: Morris 1999, Di Paolo 1994, Torelli 1995, Wagner 1997
  3. Variant-specific probes have also been used, and have been commercially available through Qiagen as a “biotinylated oligoprobe-mixture.” The sequences are given in Loginov 2010: HHV-6 variant A (5′-AAAACATTGAAGAAGTTT-3′) and variant B (5′ -AAGACATTGAAGAAGCTT-3′). The probes cover two point mutations creating variant specificity.  References: Loginov 2010, Loginov 2006, Arivananthan 1997, Yadav 1997
  4. Recently, papers have been published using “A cocktail of 8 plasmids containing between 9-kb and 16-kb inserts of the HHV-6 genome (nonoverlapping) were used as probes (seven plasmids kindly provided by Dr Scott Schmid, Centers for Disease Control, Atlanta, USA, and plasmid pZHV14 kindly provided by Professor Ruth Jarrett, University of Glasgow, UK)” No other information was given on the other 7 plasmids. References: Strenger 2011, De Pagter 2010, Nacheva 2008
  5. Research Genetics (acquired by Invitrogen) carried an HHV-6 available probe entitled U89 probe. The sequences were 5′ CTTCTGTCCCATCACTGTCAT and  3′ TCAGAGAGTGAAGATGAAG. References: Glotzbecker 2004 and Roush 2001

 

Apply for a Grant

Find out more about the HHV-6 Foundation Grant program and apply for a grant today.

Apply Now

HHV-6 Repository

Reagents for conducting HHV-6 & 7 research are available through the HHV-6 Foundation Repository

Learn More

Website development by Earthling Technologies
Earthling Technologies, Inc.